View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4316_high_5 (Length: 353)
Name: NF4316_high_5
Description: NF4316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4316_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 17 - 342
Target Start/End: Original strand, 3571893 - 3572215
Alignment:
| Q |
17 |
atctttgtctctctttttaataatgaatgaccattcgtgctcaccgtttgatgatatgatcaatgtttcattctctttcactttttccaatcccgggccc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3571893 |
atctttgtctctctttttaataatgaatgaccattcgtgctcaccgtttgatgatatgatcaatgtttcattctctttcactttttccaatcccgggccc |
3571992 |
T |
 |
| Q |
117 |
ggcaaccgcaaacgttaacaccaaataatcattcttttggcgtcatcatcagttgctggtgggtggaatatctctctctctaacattcnnnnnnnatgaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
3571993 |
ggcaaccgcaaacgttaacaccaaataatcattcttttggcgtcatcatcagttgctggtgggtggaata--tctctctctaacatt-tttttttatgaa |
3572089 |
T |
 |
| Q |
217 |
ctcaaagcttttccagtaatctagctccaactcaatagataaggagagagaaactgtaatttgagagtgacgctttattagggtttcttcatttctctca |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3572090 |
ctcaaagcttttccagtaatctagctccaactcaatagataaggagagagaaactttaatttgagagtgacgctttattagggtttcttcatttctctca |
3572189 |
T |
 |
| Q |
317 |
tctttatatatttcttcttgttctct |
342 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
3572190 |
tctttatatatttcttcttgttctct |
3572215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University