View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4317-Insertion-1 (Length: 73)
Name: NF4317-Insertion-1
Description: NF4317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4317-Insertion-1 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 56; Significance: 6e-24; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 56; E-Value: 6e-24
Query Start/End: Original strand, 6 - 73
Target Start/End: Complemental strand, 1671172 - 1671106
Alignment:
| Q |
6 |
ccttcagagacagttgtaaaacaactgttgtgtctccataataaacaatttcccacgtacattgcata |
73 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1671172 |
ccttcagagacaattgtaaaacaactgttgtgtctccataataaac-atttcccacgtacattgcata |
1671106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University