View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4317-Insertion-5 (Length: 98)
Name: NF4317-Insertion-5
Description: NF4317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4317-Insertion-5 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 94; Significance: 2e-46; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 2e-46
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 51060637 - 51060734
Alignment:
| Q |
1 |
acactatttaccttaatgttgatacaaacatataaaaatactattatagtctgacagtctgttaaaattttaacttaaaagaactatgtaaattttcc |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
51060637 |
acactatttaccttaatgttgatacaaacatataaaaatactattatagtctgacagtctgttaaaattttaacttaaaagaactatataaattttcc |
51060734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University