View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4317_low_5 (Length: 255)
Name: NF4317_low_5
Description: NF4317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4317_low_5 |
 |  |
|
| [»] scaffold0341 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 6522156 - 6522397
Alignment:
| Q |
1 |
atcaaccaacgccatcagattcaccctcgccatcaccggtgcctgtgccagtgccatctttctcaactcctcctccgtttgcacaaaacaatacttcctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6522156 |
atcaaccaacgccatcagattcaccctcgccatcaccggtgcctgtgccagtgccatctttctcaactcctcctccgtttgcacaaaacaatacttcctc |
6522255 |
T |
 |
| Q |
101 |
tcaaggtatttatggtggtttttgtatgtgtttttactatatctttgatatattaaatatttaatgtctcactatgtgttaattctggtttttgcagata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6522256 |
tcaaggtatttatggtggtttttgtatgtgtttttactatatctttgatatattaaatatttaatgtctcac--tgtgttaattctggtttttgcagata |
6522353 |
T |
 |
| Q |
201 |
agggcaacacgtcaagaaatgtcgtccctgtaattttgttgatg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6522354 |
agggcaacacgtcaagaaatgtcgtccctgtaattttgttgatg |
6522397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 49 - 112
Target Start/End: Complemental strand, 6506501 - 6506438
Alignment:
| Q |
49 |
cagtgccatctttctcaactcctcctccgtttgcacaaaacaatacttcctctcaaggtattta |
112 |
Q |
| |
|
|||||||||| |||||| |||||||||| |||||| |||||| ||||||||||| ||||||||| |
|
|
| T |
6506501 |
cagtgccatcattctcagctcctcctccatttgcagaaaacactacttcctctccaggtattta |
6506438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0341 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 2)
Name: scaffold0341
Description:
Target: scaffold0341; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 49 - 112
Target Start/End: Complemental strand, 526 - 463
Alignment:
| Q |
49 |
cagtgccatctttctcaactcctcctccgtttgcacaaaacaatacttcctctcaaggtattta |
112 |
Q |
| |
|
|||||||||| |||||| |||||||||| |||||| |||||| ||||||||||| ||||||||| |
|
|
| T |
526 |
cagtgccatcattctcagctcctcctccatttgcagaaaacactacttcctctccaggtattta |
463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0341; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 49 - 112
Target Start/End: Complemental strand, 8179 - 8116
Alignment:
| Q |
49 |
cagtgccatctttctcaactcctcctccgtttgcacaaaacaatacttcctctcaaggtattta |
112 |
Q |
| |
|
|||||||||| |||||| |||||||||| |||||| |||||| ||||||||||| ||||||||| |
|
|
| T |
8179 |
cagtgccatcattctcagctcctcctccatttgcagaaaacactacttcctctccaggtattta |
8116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University