View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4318-Insertion-15 (Length: 99)
Name: NF4318-Insertion-15
Description: NF4318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4318-Insertion-15 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 2e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 2e-49
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 41228624 - 41228526
Alignment:
| Q |
1 |
atatagcatagctgtaacttaattgacaagttattatacatgaaagatacgcaaatatatagcggctaatgaggttattgccattaatatacaggattg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41228624 |
atatagcatagctgtaacttaattgacaagttattatacatgaaagatacgcaaatatatagcggctaatgaggttattgccattaatatacaggattg |
41228526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.000000008
Query Start/End: Original strand, 40 - 99
Target Start/End: Complemental strand, 32643676 - 32643621
Alignment:
| Q |
40 |
atgaaagatacgcaaatatatagcggctaatgaggttattgccattaatatacaggattg |
99 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||| ||||||| ||||| |
|
|
| T |
32643676 |
atgaaagatacgcaaata----gcggctaatgagattattgccattcatatacatgattg |
32643621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University