View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4318-Insertion-17 (Length: 59)
Name: NF4318-Insertion-17
Description: NF4318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4318-Insertion-17 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 59; Significance: 8e-26; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 8e-26
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 2892179 - 2892237
Alignment:
| Q |
1 |
agatgaacatagaatagaagagaggtccaataagtcaagtctaggagtatgtgttactg |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2892179 |
agatgaacatagaatagaagagaggtccaataagtcaagtctaggagtatgtgttactg |
2892237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University