View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4318-Insertion-23 (Length: 194)
Name: NF4318-Insertion-23
Description: NF4318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4318-Insertion-23 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 10 - 194
Target Start/End: Original strand, 361859 - 362043
Alignment:
| Q |
10 |
attggcaaccatttttccagattttcttgatttgcaccttgattcgctgcaccctcaccaccttgacgttcaacatcatgaccaatattctgctcctgaa |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
361859 |
attggcaaccatttttgcagattttcttgatttgcaccttgattcgctgcaccctcaccaccttgacgttcaacatcatgaccaatattctgctcctgaa |
361958 |
T |
|
| Q |
110 |
ttagcgaacacgcccacaaattaaagttaatcacacatgtacacatgattgaataattgaaagtagtagtgaattgtaaagatat |
194 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
361959 |
ttaacgaacacgcccacaaattaaagttaatcacacatgtacacatgattgaataattgaaagtagtagtgaattgtaaagatat |
362043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University