View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4318-Insertion-4 (Length: 126)
Name: NF4318-Insertion-4
Description: NF4318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4318-Insertion-4 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 5e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 5e-63
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 43797534 - 43797409
Alignment:
| Q |
1 |
cataattgttatgttttgtttttgcagccattttggccggttgtgagctttaaaggcaatagaggcagaggaattgttggtaagaatgaactgcaaatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43797534 |
cataattgttatgttttgtttttgcagccattttggccagttgtgagctttaaaggcaatagaggcagaggaattgttggtaagaatgaactgcaaatta |
43797435 |
T |
 |
| Q |
101 |
cctgacgatatttagttctatttgag |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
43797434 |
cctgacgatatttagttctatttgag |
43797409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University