View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4318-Insertion-5 (Length: 135)
Name: NF4318-Insertion-5
Description: NF4318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4318-Insertion-5 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 124; Significance: 3e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 124; E-Value: 3e-64
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 34958072 - 34957937
Alignment:
| Q |
1 |
attaagacacaaaccatgatttgaaactatattacacaaattgacattcatggaagaagaaaagtttggtaaaatatagcataaatatgggatga-aaaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34958072 |
attaagacacaaaccatgatttgaaactatattacacaaattgacattcatggaagaagaaaagtttggtaaaatatagcataaatatgggatgaaaaaa |
34957973 |
T |
 |
| Q |
100 |
tagatagacccagttcaagaataatttacctcgcag |
135 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34957972 |
tagatagacccagttgaagaataatttacctcgcag |
34957937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University