View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4318_high_2 (Length: 307)
Name: NF4318_high_2
Description: NF4318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4318_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 81; Significance: 4e-38; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 114 - 198
Target Start/End: Original strand, 50111640 - 50111724
Alignment:
| Q |
114 |
tgtttccacggaccctatcaccaaacaattaaattaaaataagtgccaattttatgggtgtgatacccatcatcacaatctcaga |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
50111640 |
tgtttccacggaccctatcaccaaacaattaaattaaaataagtgccaattttaagggtgtgatacccatcatcacaatctcaga |
50111724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 33 - 95
Target Start/End: Original strand, 50111593 - 50111655
Alignment:
| Q |
33 |
taaaacaaaatatgttttataacttttcaactttatgtgtagctttatgtttccacggaccct |
95 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50111593 |
taaaacaaaatatgctttataacttttcaactttatgtgtagctttatgtttccacggaccct |
50111655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 235 - 290
Target Start/End: Original strand, 50111801 - 50111856
Alignment:
| Q |
235 |
gtatgaccaactgcattctgaaatgcatttatgtacaccatggatatgttcaagtt |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50111801 |
gtatgaccaactgcattctgaaatgcatttatgtacaccatggatatgttcaagtt |
50111856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 3 - 36
Target Start/End: Complemental strand, 26378303 - 26378270
Alignment:
| Q |
3 |
tctaaaatggttgttcaaatatcagtactctaaa |
36 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
26378303 |
tctaaaatggttgttcaaatatcactactctaaa |
26378270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 3 - 35
Target Start/End: Original strand, 51673016 - 51673048
Alignment:
| Q |
3 |
tctaaaatggttgttcaaatatcagtactctaa |
35 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
51673016 |
tctaaaatggttgttcaaatatcactactctaa |
51673048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 1095756 - 1095724
Alignment:
| Q |
1 |
tatctaaaatggttgttcaaatatcagtactct |
33 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
1095756 |
tatctaaaatggttgttcaaatttcagtactct |
1095724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University