View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4318_low_8 (Length: 237)
Name: NF4318_low_8
Description: NF4318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4318_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 17 - 110
Target Start/End: Original strand, 3332498 - 3332591
Alignment:
| Q |
17 |
ctgtgctgaacttgttgttgctgttttcttctcggtttgtgaggttgagtccaccgccgctgctacttccgctttgttcatcttgatctgtggt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3332498 |
ctgtgctgaacttgttgttgctgttttcttctcggtttgtgaggttgagtccaccgccgctgctacttccgctttgttcatcttgatctgtggt |
3332591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 177 - 222
Target Start/End: Original strand, 3332658 - 3332703
Alignment:
| Q |
177 |
atggtgaagatgaagatctcttgctgtgtggaaaggtggaggaagt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3332658 |
atggtgaagatgaagatctcttgctgtgtggaaaggtggaggaagt |
3332703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University