View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4319-Insertion-2 (Length: 148)
Name: NF4319-Insertion-2
Description: NF4319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4319-Insertion-2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 7e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 7e-72
Query Start/End: Original strand, 5 - 145
Target Start/End: Complemental strand, 50359418 - 50359278
Alignment:
| Q |
5 |
caacagtatcccttcacctctcacagtaacttcaacttgtgtgattgttgaattgcactccatcatgttgaattttctaatatctttgtatcatgctttg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
50359418 |
caacagtatcccttcacctctcacagtaacttcaacttgtgtgattgttgaattgcactccatcatgttgaattttctaatatcttagtatcatgctttg |
50359319 |
T |
 |
| Q |
105 |
tatgatggagtaacaaacctttcgaggtgctaagaatttgt |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50359318 |
tatgatggagtaacaaacctttcgaggtgctaagaatttgt |
50359278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University