View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4319-Insertion-6 (Length: 183)
Name: NF4319-Insertion-6
Description: NF4319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4319-Insertion-6 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 183
Target Start/End: Complemental strand, 5973071 - 5972884
Alignment:
| Q |
1 |
tgtgtgaagtaaatggtaatgagtaatgagggaagatgaaaatggaaagatagtttaagggttgtgattaaataagataaagtggtcgttgttgtgtgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5973071 |
tgtgtgaagtaaatggtaatgagtaatgagggaagatgaaaatggaaagatatgttaagggttgtgattaaataagataaagtggtcgttgttgtgtgta |
5972972 |
T |
|
| Q |
101 |
gggtaggtttgggttttgggtttctttgtta-----tatttcaattcaattaatgcaaagttaggaattatttttgggaaaaatgtaa |
183 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5972971 |
gggtaggtttggtttttgggtttctttgttatggagtatttcaattcaattaatgcaaagttaggaattttttttgggaaaaatgtaa |
5972884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University