View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4319-Insertion-8 (Length: 78)
Name: NF4319-Insertion-8
Description: NF4319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4319-Insertion-8 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 71; Significance: 8e-33; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 71; E-Value: 8e-33
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 43613516 - 43613438
Alignment:
| Q |
1 |
gttatttcacctcattattttttgattaacatgttttggtggataacaggccttgag-aagtatgggacgtaaaaccat |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43613516 |
gttatttcacctcattattttttgattaacatgttttggtggataacaggccttgagaaagtatgggacgtaaaaccat |
43613438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 2e-21
Query Start/End: Original strand, 12 - 78
Target Start/End: Complemental strand, 43644655 - 43644588
Alignment:
| Q |
12 |
tcattattttttgattaacatgttttggtggataacaggccttgag-aagtatgggacgtaaaaccat |
78 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
43644655 |
tcattatttttttattaacatgttttggtggataacaggccttgagaaagtatgggatgtaaaaccat |
43644588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University