View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4319_high_3 (Length: 306)

Name: NF4319_high_3
Description: NF4319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4319_high_3
NF4319_high_3
[»] chr8 (1 HSPs)
chr8 (31-98)||(9715310-9715377)


Alignment Details
Target: chr8 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 31 - 98
Target Start/End: Complemental strand, 9715377 - 9715310
Alignment:
31 tggtattactgcaacaatttcaaagttgatcacttgctaaaacatcataaacaaaaatatgtcatata 98  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9715377 tggtattactgcaacaatttcaaagttgatcacttgctaaaacatcataaacaaaaatatgtcatata 9715310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University