View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4319_high_5 (Length: 257)

Name: NF4319_high_5
Description: NF4319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4319_high_5
NF4319_high_5
[»] chr7 (1 HSPs)
chr7 (25-250)||(30850930-30851153)


Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 25 - 250
Target Start/End: Complemental strand, 30851153 - 30850930
Alignment:
25 tatcaatgtggatcctctaataaataggtataagaaagtgtgatcctctaatagacattgttatgaaatgtcatagaaagatgcatgtgttgcaaagcag 124  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30851153 tatcaatgtggatc-tctaataaataggtataagaaagtgtgatcctctaatagacattgttatgaaatgtcatagaaagatgcatgtgttgcaaagcag 30851055  T
125 aaaatggactaaaaacgtgtaatgaggctttgtggtagtttaggatggcggtggcgtctttcactttagacaaaactctccatcnnnnnnnngaaagaaa 224  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||    
30851054 aaaatggactaaaaacgtgt-atgaggctttgtggtagtttaggatggcggtggcgtctttcactttagacaaaactctccatcttttttttgaaagaaa 30850956  T
225 acaaaactttccatcttcttcatctc 250  Q
    ||||||||||| ||||||||||||||    
30850955 acaaaactttctatcttcttcatctc 30850930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University