View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4319_low_2 (Length: 342)
Name: NF4319_low_2
Description: NF4319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4319_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 17 - 239
Target Start/End: Complemental strand, 50491509 - 50491287
Alignment:
| Q |
17 |
agtataaggtgttggttgttgatatgtgaactttgtattgcagatacggatgatgacagttacaggccctctaaaagggctagagctgatcacaggtctt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50491509 |
agtataaggtgttggttgttgatatgtgaactttgtattgcagatacggatgatgacagttacaggccctctaaaagggctagagctgatcacaggtctt |
50491410 |
T |
 |
| Q |
117 |
ctgcaccgagtgacgatgatcttgatgggatgaatagttcacctggaaggtcacaaagacactcaagggaggataatccaaccacggatcaaaatgagga |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50491409 |
ctgcaccgagtgacgatgatcttgatgggatgaatagttcacctggaaggtcacaaagacactcaagggaggataatccaaccactgatcaaaatgagga |
50491310 |
T |
 |
| Q |
217 |
tgatcaatatgaggtactttcag |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
50491309 |
tgatcaatatgaggtactttcag |
50491287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 301 - 334
Target Start/End: Complemental strand, 50491225 - 50491192
Alignment:
| Q |
301 |
cggggtaatggaatgtaggaggattttgatgatg |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
50491225 |
cggggtaatggaatgtaggaggattttgatgatg |
50491192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University