View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4319_low_3 (Length: 342)
Name: NF4319_low_3
Description: NF4319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4319_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 194 - 325
Target Start/End: Original strand, 47130673 - 47130804
Alignment:
| Q |
194 |
ccatggatgccaatgggatttggaagaatccgagtcagttagtatctgtttggattgacctatttgagtttatgtactgtctgtttcagagaacgtgtga |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47130673 |
ccatggatgccaatgggatttggaagaatccgagtcagttagtatctgttttgattgacctatttgagtttatgtactgtctgtttcagagaacgtgtga |
47130772 |
T |
|
| Q |
294 |
aaacagcttacgactttaagtcataataagtt |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
47130773 |
aaacagcttacgactttaagtcataataagtt |
47130804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 40 - 118
Target Start/End: Original strand, 47130519 - 47130597
Alignment:
| Q |
40 |
gttataagattgatcaatcacttgctttcatcctgatttgattattcttgaaacctaagctatctcgtggatctgtatc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47130519 |
gttataagattgatcaatcacttgctttcatcctgatttgattattcttgaaacctaagctatctcgtggatctgtatc |
47130597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 240 - 272
Target Start/End: Complemental strand, 5152026 - 5151994
Alignment:
| Q |
240 |
tgtttggattgacctatttgagtttatgtactg |
272 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
5152026 |
tgtttggattgacctatttgagcttatgtactg |
5151994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University