View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4319_low_6 (Length: 257)
Name: NF4319_low_6
Description: NF4319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4319_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 25 - 250
Target Start/End: Complemental strand, 30851153 - 30850930
Alignment:
| Q |
25 |
tatcaatgtggatcctctaataaataggtataagaaagtgtgatcctctaatagacattgttatgaaatgtcatagaaagatgcatgtgttgcaaagcag |
124 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30851153 |
tatcaatgtggatc-tctaataaataggtataagaaagtgtgatcctctaatagacattgttatgaaatgtcatagaaagatgcatgtgttgcaaagcag |
30851055 |
T |
|
| Q |
125 |
aaaatggactaaaaacgtgtaatgaggctttgtggtagtttaggatggcggtggcgtctttcactttagacaaaactctccatcnnnnnnnngaaagaaa |
224 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30851054 |
aaaatggactaaaaacgtgt-atgaggctttgtggtagtttaggatggcggtggcgtctttcactttagacaaaactctccatcttttttttgaaagaaa |
30850956 |
T |
|
| Q |
225 |
acaaaactttccatcttcttcatctc |
250 |
Q |
| |
|
||||||||||| |||||||||||||| |
|
|
| T |
30850955 |
acaaaactttctatcttcttcatctc |
30850930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University