View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4320-Insertion-1 (Length: 54)
Name: NF4320-Insertion-1
Description: NF4320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4320-Insertion-1 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 46; Significance: 4e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 4e-18
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 47817850 - 47817797
Alignment:
| Q |
1 |
tctctgaatttgttttctcaatagatatgaaaatttgaaaccgttctttttaag |
54 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47817850 |
tctctgaatttattttctcaatagatatgaaaatttgaaaccattctttttaag |
47817797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 9e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 9e-16
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 23668865 - 23668917
Alignment:
| Q |
1 |
tctctgaatttgttttctcaatagatatgaaaatttgaaaccgttctttttaag |
54 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23668865 |
tctctgaattt-ttttctcaatagatatgaaaatttgaaaccattctttttaag |
23668917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.000000000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.000000000000004
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 9369727 - 9369779
Alignment:
| Q |
1 |
tctctgaatttgttttctcaatagatatgaaaatttgaaaccgttctttttaa |
53 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9369727 |
tctctgaatttttttactcaatagatatgaaaatttgaaaccattctttttaa |
9369779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University