View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4320-Insertion-17 (Length: 122)
Name: NF4320-Insertion-17
Description: NF4320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4320-Insertion-17 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 2e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 3 - 122
Target Start/End: Original strand, 5621897 - 5622016
Alignment:
| Q |
3 |
acttgccctggttttctcaaccattaagttgtaatagttattttttctgtagttgtcatactaacgacatctattatgctcataatatgccttacctgct |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5621897 |
acttgccctggttttctcaaccattaagttgtaatagttattttttctgtagttgtcatactaacaacatctattatgctcataatatgccttacctgct |
5621996 |
T |
|
| Q |
103 |
gcatgcaaactaaaattgct |
122 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
5621997 |
gcatgcaaactaaaattgct |
5622016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University