View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4320-Insertion-19 (Length: 164)
Name: NF4320-Insertion-19
Description: NF4320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4320-Insertion-19 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 3e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 3e-77
Query Start/End: Original strand, 7 - 164
Target Start/End: Complemental strand, 37106113 - 37105956
Alignment:
| Q |
7 |
tttatgacataacaatgaatgattacttcaactttttatgtgcattaggctataatgaaacacaaatgtcattattttcaaaaggtccttacaaatgcca |
106 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37106113 |
tttatgacataacaacgaatgattacttcaacttcttatgtgcattaggctataatgaaacacaaatgtcattattttcaaaaggtccttacaaatgcca |
37106014 |
T |
 |
| Q |
107 |
taagaattttagtatcctcaacctaaactatccttcaatcacagttccaaatctctct |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37106013 |
taagaattttagtatcctcaacctaaactatccttcaatcaccgttccaaatctctct |
37105956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University