View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4320-Insertion-2 (Length: 111)
Name: NF4320-Insertion-2
Description: NF4320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4320-Insertion-2 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 8e-43; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 8e-43
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 45052831 - 45052727
Alignment:
| Q |
1 |
ttactttcaatatttcgaatgaatgaaactgacaaaaactattctgacatgcatccgcatacgcataaatcttggaagaatcataaatttagatttttgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45052831 |
ttactttcaatatttcgaatgaatgaaactgacaaaaactattctgacatgcatccg------cataaatcttggaagaatcataaatttagatttttgc |
45052738 |
T |
 |
| Q |
101 |
ggaggcaaaga |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
45052737 |
ggaggcaaaga |
45052727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University