View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4320-Insertion-4 (Length: 231)
Name: NF4320-Insertion-4
Description: NF4320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4320-Insertion-4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 5 - 102
Target Start/End: Complemental strand, 14426591 - 14426494
Alignment:
| Q |
5 |
aggctcatcagtgtagaagtgggttatttgcatggtgattgttcgatgttctggctggaggtggaattctaaaagggtgatttgaataattgggacaa |
102 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14426591 |
aggctcatcggtgtagaagcaggttatttgcatggtgattgttcgatgttctggctggaggttgaattctaaaagggtgatttgaataattgggacaa |
14426494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 190 - 231
Target Start/End: Complemental strand, 14426406 - 14426365
Alignment:
| Q |
190 |
caagcgatggttgcttttgtttaatcatattattgaggtttt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14426406 |
caagcgatggttgcttttgtttaatcatattattgaggtttt |
14426365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University