View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4320-Insertion-5 (Length: 258)
Name: NF4320-Insertion-5
Description: NF4320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4320-Insertion-5 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 6 - 258
Target Start/End: Complemental strand, 23678798 - 23678540
Alignment:
| Q |
6 |
aaaccctgccttcaagtcactaaaaacagaaagtttcaaggaattgactacagttttgtagtcaaatatgcaataatatactcnnnnnnnnnnnngtcaa |
105 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
23678798 |
aaaccctgccttcaagtcactaaaa-cagaaagtttcaaggaattgactacagttttgtagtcaaatatgcaataagatactcttttttttttt-gtcaa |
23678701 |
T |
|
| Q |
106 |
gtaggctagtttcttgaat--------tcactttttaaggtgaataagtgagtgtctaggatttgtatattataatgtattgtccaaaccaacttagata |
197 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23678700 |
gtaggctagttacttgaatagttgaattcactttttaaggtgaataagtgagtgtccaggatttgtatattataatgcattgtccaaaccaacttagata |
23678601 |
T |
|
| Q |
198 |
tgcttatgaagttacgatgactgtgcaataagatacttacaaggcaaaatgtagtgtcctt |
258 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
23678600 |
tgcttacgaagttacgatgactgtacaataagatacttacaaggcaaaatgtagtgtcctt |
23678540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 101 - 162
Target Start/End: Complemental strand, 50755461 - 50755400
Alignment:
| Q |
101 |
gtcaagtaggctagtttcttgaattcactttttaaggtgaataagtgagtgtctaggatttg |
162 |
Q |
| |
|
||||||||| ||||| || ||||||||||| ||||||||||||||| ||||| ||| |||| |
|
|
| T |
50755461 |
gtcaagtagcctagtggctagaattcactttataaggtgaataagtgggtgtccagggtttg |
50755400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 160
Target Start/End: Original strand, 12237794 - 12237834
Alignment:
| Q |
121 |
gaattcactttttaaggtgaataagtg-agtgtctaggatt |
160 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
12237794 |
gaattcactttttaaagtgaataagtgaagtgtctaggatt |
12237834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University