View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4320-Insertion-6 (Length: 106)
Name: NF4320-Insertion-6
Description: NF4320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4320-Insertion-6 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 2e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 2e-52
Query Start/End: Original strand, 3 - 106
Target Start/End: Original strand, 12551022 - 12551125
Alignment:
| Q |
3 |
gattggtctttgggtcaagtgtgctttaaaagagggttgtgacttgtgagttcgcaagagattggaccttagactagtctaaaaccattatataatatag |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12551022 |
gattggtctttgggtcaagtgtgctttaaaagagggttgtgacttgtgagttcgcaagagattggaccttagactagtctaaaaccattatataatatag |
12551121 |
T |
 |
| Q |
103 |
ttga |
106 |
Q |
| |
|
|||| |
|
|
| T |
12551122 |
ttga |
12551125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University