View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4320-Insertion-7 (Length: 115)
Name: NF4320-Insertion-7
Description: NF4320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4320-Insertion-7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 4e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 4e-57
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 40839144 - 40839033
Alignment:
| Q |
1 |
tttttcttctatgctactatgttgactactcaatcatggttttaaattgtggtttaggtgtgattgttcttatacaacaaatattttttacaccgtcaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40839144 |
tttttcttctatgctactatgttgactactcaatcatggttttaaattgtggtttaggtgtgattgttcttatacaacaaatattttttacaccgtcaat |
40839045 |
T |
 |
| Q |
101 |
caaaataccatc |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
40839044 |
caaaataccatc |
40839033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University