View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4320-Insertion-9 (Length: 253)
Name: NF4320-Insertion-9
Description: NF4320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4320-Insertion-9 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 6903452 - 6903704
Alignment:
| Q |
1 |
ctatcccttctactcaatcatcaaatggaacttaataaagtacagggtgagttaaacactcatattgggaaggacaggaaggtggacgaatctgacataa |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6903452 |
ctatccctcctactcaatcatcaaatggaacttaataaagtacaggatgagttaaacactcatattgggaaggacaggaaggtggacgaatctgacataa |
6903551 |
T |
|
| Q |
101 |
agaacttggtctacctccaagccgttgtcaaggaaacattgcgcctatatccaccaagtccaattatcaccttgcatgcagcgatgaatgactgcacttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6903552 |
agaacttggtctacctccaagccgttgtcaaggaaacattgcgcctatatccaccaagtccaataatcaccttgcatgcagcgatgaatgactgcacttt |
6903651 |
T |
|
| Q |
201 |
ttcatgtggctatcacattcctgctggtacacagttgatagtgaatgtatgga |
253 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6903652 |
ttcatgtggttatcacattcctgctggtacacagttgatagtgaatgtatgga |
6903704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University