View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4320_high_4 (Length: 244)
Name: NF4320_high_4
Description: NF4320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4320_high_4 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 49 - 244
Target Start/End: Complemental strand, 37111723 - 37111528
Alignment:
| Q |
49 |
gaaatttatatgtcctaatccaacatactctaattaaagtctagattagagaagtaagtgtgattaccagataatgcaactagatcacttgtgtttaagc |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37111723 |
gaaatttatatgtcctaatccaacatactctaattaaagtctagattagagaagtaagtgtgattaccagataatgcaactagatcacttgtgtttaagc |
37111624 |
T |
|
| Q |
149 |
caacagcagcaaatttggcagtgacattggctaagctttcagttggattaggaatggatgtgttggcaccagattggtttgcaatcagaccatccc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37111623 |
caacagcagcaaatttggcagtgacattggctaagctttcagttggattaggaatggatgtgttggcaccagattggtttgcaatcagaccatccc |
37111528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University