View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4320_low_2 (Length: 337)
Name: NF4320_low_2
Description: NF4320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4320_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 12 - 328
Target Start/End: Complemental strand, 29175671 - 29175354
Alignment:
| Q |
12 |
tcatcactaggatgaaatctgaatcctggtggtagctttgcctcaaccatgcttatgttgctcattttttcttttctaacaaa-gatatagaagagaaat |
110 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29175671 |
tcatctctaggatgaaatctgaaccctggtggtagctttgcctcaaccatgcttatgttgctcattttttcttttctaacaaaagatatagaagagaaat |
29175572 |
T |
 |
| Q |
111 |
taagaaacaagttcaaacttcacaagtgagaattttttaaagatggaaataattatagagaaggtggagatgaaatgtgnnnnnnnnnnnnnnaatgaga |
210 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29175571 |
taagaaacaggttcaaacttcacaagtgagaattttttaaagatggaaataattatagagaaggtggagatgaaatgtgtatatatatatataaatgaga |
29175472 |
T |
 |
| Q |
211 |
gtgggaacagaagtggaaaagtcaacatgtaattgctttgaatgaggaagggtagttatgtaattaagttctatatttgcatagttataattgttattag |
310 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29175471 |
gtgggaacggaagtggaaaagtcaacatgtaattgctttgaatggggaagggtagttatgtaattaagttctatatttgcatagttataattgttattag |
29175372 |
T |
 |
| Q |
311 |
aaagatgtatgatgatgt |
328 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
29175371 |
aaagatgtatgatgatgt |
29175354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University