View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4320_low_5 (Length: 211)
Name: NF4320_low_5
Description: NF4320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4320_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 14 - 193
Target Start/End: Complemental strand, 1020933 - 1020754
Alignment:
| Q |
14 |
attatactttgtcaatacattgttttcttttaagtgtacaannnnnnnnncatggaaatttagataaaaggtgacaatataagtgctactgcattgaatc |
113 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1020933 |
attatactttgtcaatacgttgtttttttttaagtgtacaatttttttttcatggaaatttagataaaaggtgacaatataagtgctactgcattgaatc |
1020834 |
T |
 |
| Q |
114 |
aaactaaggtgagtatacaataaacttggtttatattagtatatttaacatgctactacatacttatagtttgtaattta |
193 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1020833 |
aaactaaggcgagtatacaataaacttggtttatattagtatatttaacatgctactacatacttatagtttgtaattta |
1020754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University