View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4321-Insertion-3 (Length: 126)
Name: NF4321-Insertion-3
Description: NF4321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4321-Insertion-3 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 5e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 5e-63
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 33170273 - 33170148
Alignment:
| Q |
1 |
catcttcgttttagcatcttttgaattgaaaggagtagcaatttaagtgtatttcaaaagttatattctgaatgaagagggacataaatcatttcaattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33170273 |
catcttcgttttagcatcttttgaattgaaaggagtagcaatttaagtgtatttcaaaagttatattctgaatgaagagggacataaatcatttcaattc |
33170174 |
T |
|
| Q |
101 |
aaatggggcactagggcttgtagaca |
126 |
Q |
| |
|
||||||||||||||| |||||||||| |
|
|
| T |
33170173 |
aaatggggcactaggacttgtagaca |
33170148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University