View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4321_high_2 (Length: 250)
Name: NF4321_high_2
Description: NF4321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4321_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 81; Significance: 3e-38; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 4741954 - 4741775
Alignment:
| Q |
1 |
caatgtagcaatatcgtgtcacggtttgtttcagaattcaaatcttgttttgacactcccccaaattgtttcatgaatcaattattttgcgccacgaaat |
100 |
Q |
| |
|
|||||||||||||| |||||||| || |||||||||||||||| || |||||||||||| ||||| ||||||||| || || | | |||||| |||| |
|
|
| T |
4741954 |
caatgtagcaatattgtgtcacgattagtttcagaattcaaattttattttgacactccttcaaatcgtttcatgatgcacttctctcccgccacaaaat |
4741855 |
T |
 |
| Q |
101 |
tatgtgaattgaaatgtccatttttgcttttaaaatcatggcacgatgctaaattccttggtaattgattttcctatcctt |
181 |
Q |
| |
|
||||||||||||||||| |||| ||| |||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4741854 |
tatgtgaattgaaatgttgatttatgc-tttagaattgaggcacgatgctaaattccttggtaattgattttcctatcctt |
4741775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 195 - 230
Target Start/End: Complemental strand, 4741121 - 4741086
Alignment:
| Q |
195 |
catgcattaaagaataaattattctcttatattctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
4741121 |
catgcattaaagaataaattattctcttatattctt |
4741086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 194 - 230
Target Start/End: Complemental strand, 4752969 - 4752933
Alignment:
| Q |
194 |
gcatgcattaaagaataaattattctcttatattctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4752969 |
gcatgcattaaagaataaattattctgttatattctt |
4752933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University