View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4321_high_5 (Length: 222)
Name: NF4321_high_5
Description: NF4321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4321_high_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 45; Significance: 8e-17; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 3 - 88
Target Start/End: Complemental strand, 35046175 - 35046078
Alignment:
| Q |
3 |
ggatgtcgaagaatatataaatgagttgttttggtttacaaaccttttt------------atatattcacaacctattcaaagtacatgtaggatcg |
88 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35046175 |
ggatgttgaaaaatatataaatgagttgttttggtttacaaacctttttatacggttaacaatatattcacaatctattcaaagtacatgtaggatcg |
35046078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 157 - 204
Target Start/End: Original strand, 5601581 - 5601628
Alignment:
| Q |
157 |
ttggtatgaataaagccaatgcatactatttagattacggctcatctt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5601581 |
ttggtatgaataaagccaatgcatactatttggattacggctcatctt |
5601628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 124 - 155
Target Start/End: Original strand, 5601527 - 5601558
Alignment:
| Q |
124 |
ttatcccatttcttatcactttcatgacccta |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5601527 |
ttatcccatttcttatcactttcatgacccta |
5601558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University