View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4321_low_3 (Length: 274)
Name: NF4321_low_3
Description: NF4321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4321_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 4 - 259
Target Start/End: Original strand, 38551567 - 38551836
Alignment:
| Q |
4 |
attctattcaaaatgtgtcggacaataaatatatgtatccttttagtgaatgagtatcaatatgtgttaaaattattataatttaggtttctcacatcgt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |||||||||||||||||| ||||||||| ||||| |
|
|
| T |
38551567 |
attctattcaaaatgtgtcggacaataaatatgtgtatccttttagtgagtgagtatcaatatgtattaaaattattataattttggtttctcatatcgt |
38551666 |
T |
 |
| Q |
104 |
gctcgtgtgagtatctaacccctcttcttgacccaacctctattagttctttcttgattaagaagttcagtaaacaaataaaa--------------gaa |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
38551667 |
gctcgtgtgagtatctaacccctcttcttgacccaacctctattagttctttcttgattaagaagttcagtaaacaaataaaagaaaatagaaactcgaa |
38551766 |
T |
 |
| Q |
190 |
aatagaaacttcagactttttcagtcataatacttagcaccaaaagctaccaatattagtgcatcatcat |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38551767 |
aatagaaacttcagactttttcagtcataatacttagcaccaaaagctaccaatattagtgcatcatcat |
38551836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University