View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4322-Insertion-11 (Length: 222)
Name: NF4322-Insertion-11
Description: NF4322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4322-Insertion-11 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 37 - 222
Target Start/End: Complemental strand, 23356441 - 23356256
Alignment:
| Q |
37 |
cactttgtgtcacgcattcttaaaaaaccttaacccttataacatgcatcgtatagttaattttggctttaatgtttgtttttcaaaacttgcattccat |
136 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23356441 |
cactatgtgtcacgcattcttaaaaa-ccttaacccttataacatgcatcgtgtagttaatttcggctttaatgtttg-ttttcaaaacttgcattccat |
23356344 |
T |
 |
| Q |
137 |
gcannnnnnnna--atatacctaatgtcatgcatttttagttggtatttgttttcgtatgtgatgttcttttaaacctgtttggttca |
222 |
Q |
| |
|
||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23356343 |
gcattttttttaatatatacctaatgtcatgcatttttagttggtatttgttttcgtatgtgatgttcttttaaacctgtttggttca |
23356256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University