View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4322-Insertion-13 (Length: 237)
Name: NF4322-Insertion-13
Description: NF4322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4322-Insertion-13 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 43806071 - 43805835
Alignment:
| Q |
1 |
ccaaatgatattgaaaatgttagttatggaggtaaggatggctaacttgcattgaaggttccaaatgtttttagtaaagaagcattgacaaaaaaggtgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43806071 |
ccaaatgatattgaaaatgttagttatggaggtaaggatggctaacttgcattgaaggttccaaatgtttttagtaaagaagcattgacaaaaaaggtgc |
43805972 |
T |
|
| Q |
101 |
attgaagattcagaaatccttccaagaaagtttgcagatagaggctatgttgcttccccttgtcaattgtcattaaggaataatcagtaggaagcttgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43805971 |
attgaagattcagaaatccttccaagaaaggttgcagatagaggctatgttgcttccccttgtcaattgtcattaaggaataatcagtaggaagcttgtt |
43805872 |
T |
|
| Q |
201 |
atggagcaatctccgaatattgattttccgtcattga |
237 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43805871 |
atggagcaatctccgaatattgattttctgtcattga |
43805835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University