View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4322-Insertion-22 (Length: 293)
Name: NF4322-Insertion-22
Description: NF4322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4322-Insertion-22 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 293
Target Start/End: Complemental strand, 25814334 - 25814041
Alignment:
| Q |
1 |
tggtaaaggtgaggacaatcattttggaactagaaatggttaaatggtagcacttgcttggctcctctagtggataaacaccttatgcttaatcacacat |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25814334 |
tggtaaaggtgaggacagtcattttggaactagaaatggttaaatggtagcacttgcctggctcctctagtggataaacaccttatgcttaatcatacat |
25814235 |
T |
 |
| Q |
101 |
gtcaaaattgctttttgtctctgcagattacttaaatattgaatggattc-ttaaaggaaactttgaatccactttaaatgcttggtgcttaatgatacg |
199 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25814234 |
gtcaaatttgctttttgtctctgcagattacttaaatattgaatggattctttaaaggaaactttgaatccaatttaaatgcttggtgcttaatgatacg |
25814135 |
T |
 |
| Q |
200 |
actcaattatttttaacaagcaaaatgagatatattacgaacaagagagaatctttggtggcatgtatcaatgaagactttaaaagtatacaag |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25814134 |
actcaattatttttaacaagcaaaatgagatatattacgaacaaaagagaatccttgatggcatgtatcaataaagactttaaaagtatacaag |
25814041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 209 - 237
Target Start/End: Original strand, 55145278 - 55145306
Alignment:
| Q |
209 |
tttttaacaagcaaaatgagatatattac |
237 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
55145278 |
tttttaacaagcaaaatgagatatattac |
55145306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University