View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4322-Insertion-24 (Length: 188)
Name: NF4322-Insertion-24
Description: NF4322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4322-Insertion-24 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 3e-99; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 6 - 188
Target Start/End: Original strand, 50724546 - 50724728
Alignment:
| Q |
6 |
tcagggacattatttgttactgtcactgaggatgtactatttgaatgacatgatggtgcataaatgttgtatatatcaatttctgagtaatcatggaaaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50724546 |
tcagggacattatttgttactgtcactgaggatgtactatttgaatgacatgatggtgcataaatgttgtatatatcaatttctgagtaatcatggaaaa |
50724645 |
T |
|
| Q |
106 |
cttcactcatgacctgattgcactcattagaccattgagattgtttgaaatcacaaacttgttttgctttctcatattgctga |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50724646 |
cttcactcatgacctgattgcactcattagaccattgagattgtttgaaatcacaaacttgttttgctttctcatattgctga |
50724728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 5e-33
Query Start/End: Original strand, 35 - 186
Target Start/End: Original strand, 50731876 - 50732027
Alignment:
| Q |
35 |
ggatgtactatttgaatgacatgatggtgcataaatgttgtatatatcaatttctgagtaatcatggaaaacttcactcatgacctgattgcactcatta |
134 |
Q |
| |
|
||||||||||||| || |||||| || |||||||||||| |||| ||||||||||| ||||||||||| | || |||| ||||| |||||||||| |
|
|
| T |
50731876 |
ggatgtactatttaaacgacatgcaggggcataaatgttgaatatgtcaatttctgaataatcatggaagagttggtccatggcctgaaagcactcatta |
50731975 |
T |
|
| Q |
135 |
gaccattgagattgtttgaaatcacaaacttgttttgctttctcatattgct |
186 |
Q |
| |
|
|||||| || ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
50731976 |
gaccatcgaaattgtttaaaatcacaaacttgttttgctttctcatattgct |
50732027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University