View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4322-Insertion-4 (Length: 123)
Name: NF4322-Insertion-4
Description: NF4322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4322-Insertion-4 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 89; Significance: 2e-43; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 2e-43
Query Start/End: Original strand, 5 - 123
Target Start/End: Original strand, 12152562 - 12152677
Alignment:
| Q |
5 |
tgttgtgctcatcattaagctcctagtctaagcatgtcttgcgtgtccaaataatcatcgataggcaaattaagcacaacaagtttaaaatatctgcaag |
104 |
Q |
| |
|
|||||||||||||||||||||||||| | ||| |||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12152562 |
tgttgtgctcatcattaagctcctaggccaaggatgtcttgcgagtccaaat---catcgataggcaaattaagcacaacaagtttaaaatatctgcaag |
12152658 |
T |
 |
| Q |
105 |
tatttgaaaataaaataag |
123 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
12152659 |
tatttgaaaataaaataag |
12152677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University