View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4322-Insertion-8 (Length: 174)
Name: NF4322-Insertion-8
Description: NF4322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4322-Insertion-8 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 6e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 6e-48
Query Start/End: Original strand, 70 - 174
Target Start/End: Original strand, 50788151 - 50788254
Alignment:
| Q |
70 |
gacaaagattaagacgagctggatatgacaaaacaaattgtgataagagaaagcatgagaaagtgatgtatcatagattcaaatctttgaagacaaatta |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50788151 |
gacaaagattaagacgagctggatatgacaaa-caaattgtgataagagaaagcatgagaaagtgatgtatcatagattcaaatctttgaagacaaatta |
50788249 |
T |
 |
| Q |
170 |
aaata |
174 |
Q |
| |
|
||||| |
|
|
| T |
50788250 |
aaata |
50788254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University