View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4323-Insertion-1 (Length: 240)
Name: NF4323-Insertion-1
Description: NF4323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4323-Insertion-1 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 2 - 240
Target Start/End: Complemental strand, 40624824 - 40624586
Alignment:
| Q |
2 |
acagtctagtagtgactaactagcttgccctcactcaaaagctgaaaagtcttttatgtatgtgtgtagtactgacatagtgacatgtttgttgttttag |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40624824 |
acagtctagtagtgactaactagcttgccctcactcaaaagctgaaaagtcttttatgtatgtgtgtagtactgacatagtgacatgtttgttgttttag |
40624725 |
T |
|
| Q |
102 |
taatggccactagattgtcataaacatggcaaataagtggaccaaatcaagcatggtgaggtagctagccagccagccaagtgcattatgtaatttttgt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40624724 |
taatggccactagattgtcataaacatggcaaataagtggaccaaatcaagcatggtgaggtagctagccagccagccaagtgcattatgtaatttttgt |
40624625 |
T |
|
| Q |
202 |
gttatttctgactcttttaagatgtttgtacctatgtgg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40624624 |
gttatttctgactcttttaagatgtttgtacctatgtgg |
40624586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University