View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4323-Insertion-11 (Length: 212)
Name: NF4323-Insertion-11
Description: NF4323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4323-Insertion-11 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 4360311 - 4360525
Alignment:
| Q |
1 |
gcatcacagacagacagtggagattgtaagttgttactaagttcaattcaacttttgtcatgttttctgtgtttggagattgatatattcatcacatttt |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4360311 |
gcatcacagacagaccgtggagattgtaagttgttactaagttcaattcaacttttgtcatgttttctgtgtttggagattgatatattcatcacattta |
4360410 |
T |
|
| Q |
101 |
ttgtttatatcttatcatatctcaacaaaaaagaaaggaaatattgtgcttttccagcccctgta---cttagtatagtagacggacgatatctaggatg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
4360411 |
ttgtttatatcttatcatatctcaacaataaagaaaggaaatattgtgcttttccagcccctgtacttcttagtatagtagtcggacgatatctaggatg |
4360510 |
T |
|
| Q |
198 |
gagaagtgtctcata |
212 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
4360511 |
gagaagtgtctcata |
4360525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University