View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4323-Insertion-13 (Length: 81)
Name: NF4323-Insertion-13
Description: NF4323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4323-Insertion-13 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 65; Significance: 3e-29; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 3e-29
Query Start/End: Original strand, 6 - 81
Target Start/End: Original strand, 39477086 - 39477164
Alignment:
| Q |
6 |
gtcactcttgtaatatgtaaggccttaaa---tgcccgattgaatttcatataagggtaattttaaagtgaaccaactt |
81 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39477086 |
gtcactcttgtaatatgtaaggccttaaaccatgcccgattgaatttcatataagggtaattttaaagtgaaccaactt |
39477164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 1e-19
Query Start/End: Original strand, 14 - 81
Target Start/End: Original strand, 39484804 - 39484874
Alignment:
| Q |
14 |
tgtaatatgtaaggccttaa---atgcccgattgaatttcatataagggtaattttaaagtgaaccaactt |
81 |
Q |
| |
|
|||||| ||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39484804 |
tgtaatttgtaatgccttaagccatgcccgattgaatttcatataagggtaattttaaagtgaaccaactt |
39484874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University