View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4323-Insertion-14 (Length: 117)
Name: NF4323-Insertion-14
Description: NF4323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4323-Insertion-14 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 7e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 7e-56
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 52810921 - 52810804
Alignment:
| Q |
1 |
tggaggacaccaaccaaccttagcaacctttggagctgaccaatatgatgagaggaatccaaaagagaggagtttaaaagtagctttcttctgtta-ttt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
52810921 |
tggaggacaccaaccaaccttagcaacctttggagctgaccaatatgatgagaggaatccaaaagagaggagtttaaaagtagctttcttctgttatttt |
52810822 |
T |
 |
| Q |
100 |
tacttttccctcaacgtt |
117 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
52810821 |
tacttttccctcaacgtt |
52810804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.000000009
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 3804054 - 3804004
Alignment:
| Q |
1 |
tggaggacaccaaccaaccttagcaacctttggagctgaccaatatgatga |
51 |
Q |
| |
|
|||||| || ||||| ||||||||||||||||||||||| |||| |||||| |
|
|
| T |
3804054 |
tggagggcatcaacctaccttagcaacctttggagctgatcaatttgatga |
3804004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University