View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4323-Insertion-2 (Length: 51)
Name: NF4323-Insertion-2
Description: NF4323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4323-Insertion-2 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 43; Significance: 2e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 2e-16
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 55011416 - 55011465
Alignment:
| Q |
1 |
cagaagtggcgtgcgaattcaggtttgagtgatgggtgggacttacaacac |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
55011416 |
cagaagtggcgtgcgaattcaggtttgagtgatgggt-ggacttacaacac |
55011465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University