View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4323-Insertion-4 (Length: 131)
Name: NF4323-Insertion-4
Description: NF4323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4323-Insertion-4 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 68; Significance: 9e-31; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 9e-31
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 40207859 - 40207732
Alignment:
| Q |
1 |
atttctagccaaatactctcaatggcctgtagtaacattgggtcctaattggtgcatgattaaacatagaatcgagnnnnnnnnnnnnnnaattatctgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||||| |||||||||| |
|
|
| T |
40207859 |
atttctagccaaatactctcaatggcctgcagtaacattgggtcctaattggtgctaggttaaacatagaatcgag---gtgtgtgtgtaaattatctgt |
40207763 |
T |
|
| Q |
101 |
gcttatcatattcacaatcgttttcatgtta |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
40207762 |
gcttatcatattcacaatcgttttcatgtta |
40207732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University