View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4323-Insertion-7 (Length: 192)
Name: NF4323-Insertion-7
Description: NF4323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4323-Insertion-7 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 5 - 192
Target Start/End: Original strand, 44823263 - 44823450
Alignment:
| Q |
5 |
ataacatgtgtctaaagtgaccggcaacttacaatttcaagtacatttttgtcaatttatcaaatttagggactaacctaacaacaccttacaatatgaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44823263 |
ataacatgtgtctaaagtgaccggcaacttacaatttcaagtacatttttgtcaatttatcaaatttagggactaacctaacaacaccttacaatatgaa |
44823362 |
T |
|
| Q |
105 |
ggactggaataaagttttactctaatagagggccttgaatatctcgcagaaaatgaaaggttttattctatatattggggttgggatc |
192 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44823363 |
ggactagaataaagttttactctaatagagggccttgaatatctcgcagaaaatgaaaggttttattctatatattggggttgggatc |
44823450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 28; Significance: 0.000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 28; E-Value: 0.000001
Query Start/End: Original strand, 16 - 99
Target Start/End: Original strand, 13724900 - 13724983
Alignment:
| Q |
16 |
ctaaagtgaccggcaacttacaatttcaagtacatttttgtcaatttatcaaatttagggactaacctaacaacaccttacaat |
99 |
Q |
| |
|
||||| |||||| ||| |||||| |||| | | |||||||||||||| | || ||||||||||||| | |||||| | |||||| |
|
|
| T |
13724900 |
ctaaaatgaccgacaatttacaacttcagggatatttttgtcaatttcttaattttagggactaacttgacaacatcctacaat |
13724983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University