View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4323-Insertion-9 (Length: 127)
Name: NF4323-Insertion-9
Description: NF4323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4323-Insertion-9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 8e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 8e-62
Query Start/End: Original strand, 5 - 124
Target Start/End: Original strand, 53842755 - 53842874
Alignment:
| Q |
5 |
acattgattttgtaggactctttatcatcttcaacgctgtttgttatgtttgtttgattttgtttattcacaaaaccttggggttgagggtattagattt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53842755 |
acattgattttgtaggactctttatcatcttcaacgctgtttgttatgtttgtttgattttgtttattcacaaaaccttggggttgagggtattagattt |
53842854 |
T |
|
| Q |
105 |
ttgttttctggaaaggtaaa |
124 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
53842855 |
ttgttttctggaaaggtaaa |
53842874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.0000000000007
Query Start/End: Original strand, 71 - 112
Target Start/End: Original strand, 53844516 - 53844557
Alignment:
| Q |
71 |
ttcacaaaaccttggggttgagggtattagatttttgttttc |
112 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
53844516 |
ttcacaaaaccttgaggttgagggtattagatttttgttttc |
53844557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University