View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4323_high_2 (Length: 233)
Name: NF4323_high_2
Description: NF4323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4323_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 17 - 181
Target Start/End: Original strand, 40207854 - 40208021
Alignment:
| Q |
17 |
agaaatccaacaagatctactgatgaatcagcattatgttcaccccttgtatacaatattgacatatcatagatcatatagagtaacaagcaatcaaata |
116 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40207854 |
agaaatccaacaacatctactgatgaatcagcattatgttcaccccttgtatacaatattgacatatcatagatcatatagagtaacaagcaatcaaata |
40207953 |
T |
 |
| Q |
117 |
actgacaataggacgataaattcaa---gaagaaatggaactttgaacaatattaactttcaatgcaa |
181 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40207954 |
actgacaataggacgataaattcaagctgcagaaatggaactttgaacaatattcactttcaatgcaa |
40208021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University